Storage Condition

-20℃

Components

Description

Primer-flexible one-step reverse transcription premix with M-MLV GIII Reverse Transcriptase, RNase inhibitor, dNTPs, and reaction buffer. Designed for diverse experimental needs with Oligo(dT)₂₀VN, Random hexamers, or Gene-Specific Primers. Generates cDNA up to 12 kb in ~15 minutes.

Heat-labile dsDNase efficiently removes gDNA and is inactivated during RT, avoiding EDTA and ensuring high accuracy in gene-expression analysis.

Protocol — Total RNA

1) gDNA removal (10 μl)

• Total RNA: 50 ng – 1 μg
• dsDNase: 1 μl
• 10× dsDNase Buffer: 1 μl
• Nuclease-Free Water: to 10 μl

Incubate 37℃ for 2–5 min → 65℃ 2 min; then place on ice.

2) First-strand cDNA synthesis (20 μl)

• Reaction product: 10 μl
• RTase III Premix: 4 μl
• Primer: 1 μl Oligo(dT)VN or 1 μl Random hexamers or 0.1 μl GSP
• Nuclease-Free Water: to 20 μl

Incubate 55℃ 15 min (optional 25℃ 10 min pre-step if no poly(A) tail) → 85℃ 5 min; hold on ice.

Protocol — miRNA

1) gDNA removal (10 μl)

• miRNA: 10 pg – 200 ng
• dsDNase: 1 μl
• 10× dsDNase Buffer: 1 μl
• Nuclease-Free Water: to 10 μl

Incubate 37℃ for 2–5 min → 65℃ 2 min; then place on ice.

2) First-strand cDNA synthesis (20 μl)

• Reaction product: 10 μl
• RTase III Premix: 4 μl
• Stem-loop primer (5 μM): 1 μl (final 0.25 μM; range 0.1–0.5 μM)
• Nuclease-Free Water: to 20 μl

Incubate 55℃ 15 min → 85℃ 5 min; hold on ice.

miRNA Primer Design

1. Universal stem-loop backbone: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC
2. Customize last 6 bases to match the miRNA 3′ end.
3. qPCR Fwd = remaining miRNA (U→T); adjust GC at 5′ if Tm too low.
4. qPCR Rev (universal): GTGCAGGGTCCGAGGT

Notice

• Gently invert to mix; avoid bubbles; brief spin before use.
• Maintain RNase-free workspace.
• Wear gloves and masks; use RNase-free tips/tubes.